Cell culture
K-562 cells were cultured in RPMI medium (Gibco, 11875093) supplemented with 10% FBS and 100 µg ml−1 penicillin–streptomycin (Gibco, 15140122).
hTERT-immortalized retinal pigmental epithelium (hTERT RPE-1) cell lines were cultured in DMEM, supplemented with 10% FBS and 100 µg ml−1 penicillin–streptomycin. The RPE-1 cell line invalidated for TP53 (RPE-1 p53−/−) was a gift from Stephen Jackson34.
For scRNA-seq experiments, human G-CSF-mobilized CD34+ HSPCs from adult healthy donors were purchased from the Fred Hutchinson Cancer Center and cultured in StemSpan SFEM II media (STEMCELL Technologies, 09655) supplemented with StemSpan CC110 (1×) (STEMCELL Technologies, 02697) and 100 µg ml−1 penicillin–streptomycin.
For editing experiments, mobilized human peripheral blood CD34+ HSPCs (STEMCELL Technologies) were cultured in StemSpan SFEM II medium supplemented with 100 ng µl−1 each of FLT3-L, TPO and SCF (Miltenyi Biotec, 130-096-474, 130-095-745 and 130-096-491) as well as 750 nM SR1 and 35 nM UM729 (STEMCELL Technologies, 72342 and 72332).
During routine culture, human upper airway organoids were seeded in six-well plates in 15 μl of basement membrane extract (BME) droplets and polymerized for 30 min at 37 °C. After BME solidification, organoid-specific culture medium (Supplementary Table 3) was added, and the organoids were cultured at 37 °C until further use. For each passage (every 4–6 d), the organoids were dissociated mechanically, washed to remove remaining BME and seeded at half the density in fresh BME. The human nasal epithelial samples were collected from healthy volunteers, in accordance with ethical guidelines of the ETH Zürich Ethics Commission (EK-2024-N-171-A) and the Cantonal Ethics Committee Zürich (Req-2O24-OO558).
The hTERT RPE-1 p53+/+, hTERT RPE-1 p53−/−, K-562 and K-562 eGFP cell lines were short tandem repeat (STR) profiled and tested negative for mycoplasma. All cells were cultured at 37 °C and 5% CO2 in a humidified chamber.
FIRE reporter generation
The polyclonal FIRE reporter cell line was generated by lentiviral transduction of K-562 cells. In brief, lentiviruses were produced by transient transfection of a lentiviral transfer plasmid containing the reporter construct as well as a G418 resistance cassette into the GPRTG lentivirus producer cell line35,36. The lentiviral vector used in this study for generation of the polyclonal FIRE reporter is derived from the pCL20c vector backbone35. Sequences of interest were generated by gene synthesis and cloned into the vector backbone by GenScript.
Lentivirus-containing supernatant was collected 2 d after transfection, filtered through a 0.22-µm filter and used for transduction of K-562 cells at different dilutions to generate polyclonal cell lines with different vector copy numbers (VCNs). Four days after transduction, cells were treated with 800 µg ml−1 G418 for 7 d, after which cells were cultured in the presence of 400 µg ml−1 G418. After 7 d of initial selection, genomic DNA (gDNA) was extracted to measure the average VCN of integrated sequences by ddPCR. Cells with an average VCN of approximately 1 were selected for subsequent experiments.
Editing reagents
Editing reagents used are summarized in Supplementary Table 1. All experiments were conducted with in-house-produced SpCas9–NLS (40 µM) using previously published protocols, except for HSPC editing for which Alt-R S.p. Cas9 Nuclease V3 (Integrated DNA Technologies (IDT)) was used37. Synthetic guide RNAs were ordered from IDT (Alt-R CRISPR–Cas9 sgRNA) or Synthego (CRISPRevolution sgRNA EZ Kit) or produced by in vitro transcription (IVT) as described here: https://doi.org/10.17504/protocols.io.n2bvjyp5vk5w/v17 (ref. 38). For IVT, overlapping oligomers containing a T7 promoter, the desired protospacer and gRNA scaffold were amplified using Phusion polymerase (New England Biolabs (NEB), M0530L). The unpurified DNA product was then subjected to IVT using an NEB HiScribe T7 High Yield RNA Synthesis Kit (NEB, E2040L), incubating at 37 °C for 16 h. The next day, RNA was treated first with DNase I followed by recombinant Shrimp Alkaline Phosphatase (NEB, M0371S), purified with an miRNeasy kit (Qiagen, 217084), concentration measured by a NanoDrop 8000 spectrophotometer and frozen at −80 °C. ssODNs were ordered from IDT (Alt-R HDR Donor Oligo), GenScript (GenExact single-stranded DNA) or Microsynth. AZD7648 was purchased from Selleck Chemicals (S8843) and PolQi2 from MedChemExpress (HY-150279).
Electroporation and DNA repair inhibition
Cells were edited by electroporation of a Cas9–sgRNA ribonucleoprotein (RNP) with co-delivery of ssODN when specified using 4D-Nucleofector X Unit (Lonza, AAF-1003X). Number of electroporated cells, amount of editing reagents, nucleofection kit and program used per cell type are indicated in Supplementary Table 4.
In brief, RNPs were initially formed by combining the Cas9 protein with sgRNA and incubating the mixture for 10 min at room temperature. Subsequently, ssODNs were added to the RNPs.
For editing of K-562 and RPE-1, cells were pelleted and washed once with PBS before being resuspended in the nucleofection solution. Electroporations were conducted in 20-μl Nucleocuvette Strips or in 100-μl single Nucleocuvettes using Lonza 4D electroporation kits (Supplementary Table 4). After electroporation, cells were allowed to recover for 10 min at room temperature before being transferred to six-well plates or Petri dishes containing media and 1 µM AZD7648 and 3 µM PolQi2 where indicated for 3 d before gDNA collection.
For editing of HSPCs, cells were thawed and cultured at a concentration of 0.25 × 106 cells per milliliter for 48 h before electroporation. RNP and cells were prepared for electroporation as described above, and transfections were conducted in 20-µl strips (2 × 105 cells per well) in triplicates. Immediately after electroporation, 80 µl of culture medium was added to each well, and cells were allowed to recover for 5 min at 37 °C before being transferred to 48-well plates containing medium (final concentration of 1 × 106 cells per milliliter) and 1 µM AZD7648 where indicated. Twenty-four hours after electroporation, cells were diluted by the addition of 600 µl of culture medium. Three days after electroporation, replicates were pooled before genomic DNA extraction.
Human HSPCs for scRNA-seq were electroporated 1 d after thawing in 100-μl single Nucleocuvette (1 × 106 cells per cuvette). Edited cells were collected 48 h after electroporation for scRNA-seq library preparation.
For editing experiments, upper airway organoids were extracted from BME by pre-treatment with 2 U ml−1 Dispase II (Gibco, 17105041) for 30 min at 37 °C, followed by mechanical disruption and digestion with TrypLE (Gibco, 12604021) for 30 min at 37 °C. After digestion, cells were washed and strained through a 70-µm strainer and counted. In total, 1 × 106 cells were then washed with PBS and resuspended in SE nucleofection buffer containing Cas9, the guide RNA and ssODN (Supplementary Table 4). For cells to recover after the electroporation, complete warm culture medium was added to the cuvettes, and cells were incubated for 15 min at room temperature. After that, cells were transferred from the cuvettes to microcentrifuge tubes and pelleted (300g for 3 min). Afterwards, the cell pellet was resuspended in cold BME and plated as drops containing 25–100 × 105 cells per drop. The cells were then cultured in complete culture medium containing 10 µM Y-27632 (TOCRIS, 1254) with or without AZD7648. After 3 d, cells were extracted from BME by mechanical disruption and TrypLE digestion and immediately subjected to the downstream analysis.
Flow cytometry
Edited K-562 cells expressing the FIRE reporter were transferred 3 d after electroporation to a 96-well plate and analyzed for mScarlet and eGFP expression using an Attune NxT Flow Cytometer (Thermo Fisher Scientific). Cells were first gated on morphology (FSC-A versus SSC-A), for single cells (FSC-A versus FSC-H) and then on mScarlet and eGFP expression. The gating strategy is shown in Extended Data Fig. 2b.
Edited K-562 cells expressing eGFP were transferred 6 d after electroporation to a 96-well plate and analyzed for eGFP expression using an Attune NxT Flow Cytometer and Attune NxT Software version 3.2.1. Cells were first gated on morphology (FSC-A versus SSC-A), for single cells (FSC-A versus FSC-H) and then on eGFP expression. The gating strategy is shown in Extended Data Fig. 4c. Cell sorting of eGFP+ and eGFP− fractions was performed using an SH800S Cell Sorter (Sony) and Cell Sorter Software version 2.1.6. Cell viability of GAPDH-edited HSPCs analyzed by scRNA-seq was also quantified using SYTOX Red Dead Cell Stain (1:1,000 dilution) (Invitrogen, S34859). Flow cytometry data were analyzed in FlowJo 10.8.1.
gDNA extraction
gDNA was extracted 3 d after electroporation using a DNeasy Blood and Tissue Kit (Qiagen, 69504) following the manufacturer’s instructions or using phenol-chloroform for GAPDH-edited RPE-1 and human upper airway organoids. For phenol-chloroform extraction, one volume of phenol:chloroform:isoamyl alcohol (25:24:1) was added to the sample to extract DNA into the aqueous phase, and ethanol together with ammonium acetate was used to precipitate the purified DNA. For HSPCs, gDNA was extracted with a Maxwell RSC Cultured Cell DNA Kit (Promega, AS1620) according to the manufacturer’s instructions. All DNA samples were quantified by using the NanoDrop 8000 spectrophotometer or Qubit fluorometers (APP 2.02 + MCU version 0.26) (Thermo Fisher Scientific).
Amplicon sequencing
Primer sequences used for amplicon sequencing are listed in Supplementary Table 5. Primers were designed to amplify a 150–250-bp region surrounding the cut site. gDNA was amplified (25× PCR cycles) using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and locus-specific primers including Illumina adapter sequences. Indexing PCR was then performed by amplifying (8× cycles) 10 ng of generated PCR products using NEBNext High-Fidelity 2× PCR Master Mix and primers including i7 / i5 Illumina indexes. PCR products were purified using 1.8× homemade SPRI beads after each PCR and quantified using Quant-iT dsDNA Assay Kits (Thermo Fisher Scientific, Q33120) and a VICTOR Nivo Microplate Reader with control software version 4.0.7 (PerkinElmer) or Qubit 4.0 Fluorometer (APP 2.02 + MCU version 0.26). After indexing PCR, samples were normalized and pooled before a final purification step using 0.8× SPRI beads. The samples were sequenced either with a MiSeq 2 × 150 paired-end or a NextSeq 2000 2 × 150 paired-end (Illumina) with a target average read count per amplicon of 200,000 reads. Illumina reads were demultiplexed and analyzed with CRISPResso2 (version 2.0.20b) in batch mode and with a quantification window size of 30 bp and default settings for the remaining parameters39. For indels and HDR quantification, reads with frequencies lower than 0.2% were excluded, and partial HDR reads were aggregated with the HDR fraction.
For GAPDH-edited RPE-1 samples, a 12-nucleotide substitution barcode was employed to uniquely tag HDR events. Reads were categorized into three groups. Initially, HDR and unedited reads were isolated using specific sequence anchors (‘CCCCCACCACACTGAATCTC’ and ‘AGAGGGGAGGGGCCTAGGGA’) with a fixed distance of 32 bp between them. The remaining reads were extracted and subjected to CRISPResso2 analysis in batch mode to determine indel frequency. From the selected reads, HDR reads were differentiated from unedited reads based on a Hamming distance of at least 11 from a wild-type reference sequence (‘CCTCACAGTTGCCAT’ – located between the two anchors). The fraction of HDR reads compared to the total read count was then used to calculate the HDR rate.
Nanopore sequencing
Primer sequences used for Oxford Nanopore Technologies sequencing (ONT-seq) are listed in Supplementary Table 5. In total, 500 ng of gDNA was amplified using NEBNext High-Fidelity 2× PCR Master Mix and locus-specific primers containing 5′ tail Nanopore adapter sequences to yield PCR fragments ranging from 3.8 kb to 5.9 kb. The PCR cycling conditions included an initial denaturation at 98 °C for 30 s, followed by 25 cycles of denaturation at 98 °C for 10 s, annealing at 60 °C for 30 s, extension at 72 °C for 3 min and a final extension at 72 °C for 3 min. PCR products were purified using 0.8× homemade SPRI beads and quantified using Quant-iT dsDNA Assay Kits (Thermo Fisher Scientific) and VICTOR Nivo Microplate Reader (PerkinElmer). Then, 10 ng of PCR products was used for barcoding PCR using NEBNext High-Fidelity 2× PCR Master Mix and primers from PCR Barcoding Expansion 1–96 kit (ONT, EXP-PBC096). The PCR cycling conditions included an initial denaturation at 98 °C for 30 s, followed by six cycles of denaturation at 98 °C for 10 s, annealing at 62 °C for 15 s, extension at 72 °C for 3 min and a final extension at 72 °C for 3 min. Products of barcoding PCR were purified and quantified as previously described. PCR products were again purified using 0.8× homemade SPRI beads and quantified. The PCR products were evenly pooled to form a library containing 1 µg of DNA in 49 µl of water. End-prep, adapter ligation and clean-up were performed following the manufacturer’s instructions. Short-fragment buffer was used for final washing steps. Sequencing was performed by loading 25–30 fmol of DNA in MinION flow cell of GridION or Mk1C device.
Long-read sequencing data analysis
ONT-seq of PCR amplicons was performed by the Functional Genomics Center Zürich (FGCZ) and provided as demultiplexed FASTQ data files.
FASTQ files were pre-processed using three consecutive rounds of Cutadapt (version 4.6). In Cutadapt round 1, reads were filtered and trimmed for intact end-to-end amplicons using the complete stubbing primer sequences for ONT-seq. In Cutadapt round 2, the reads were further filtered for amplicons specific to the genomic locus of interest using 30-bp gDNA sequences immediately following the round 1 primer binding sites. In Cutadapt round 3, amplicons larger than the unedited amplicon were discarded; a +20-bp size buffer was allowed to accommodate for innate errors in ONT-seq data.
As a quality control step, the surviving reads were aligned to the human genome (GRCh38) using minimap2 (version 2.24-r1122), and genome-wide coverage was calculated as counts per million (CPM) in 10-kbp bins using deepTools (version 3.5.4). In properly configured Cutadapt workflows, the majority (>95%) of reads after Cutadapt round 3 will align to the target genomic region for amplicon ONT-seq in unedited cells.
Indel rates and sizes were calculated from those reads passing all rounds of Cutadapt processing. Read lengths were extracted for all reads (bioawk, version 1.0) and counted. For each read length count, the fraction of total reads of greater length was calculated and plotted.
A summary of reads passing each Cutadapt processing step and genome alignment regions are provided in Supplementary Table 6. DNA sequences used in Cutadapt round 1 and round 2 are provided in Supplementary Table 7. The bash script and example input files used to summarize amplicon ONT-seq data are available online (https://github.com/cornlab/summarizeOntDeletions).
scRNA-seq
Cells were sequenced using Chromium Controller (Firmware version 4.0) and Chromium Next GEM Single Cell 3′ Reagent Kits version 3.1 (10x Genomics) according to the manufacturer’s specifications. Libraries were sequenced by the FGCZ. Doublets, empty droplets and unhealthy cells were filtered out with Seurat (version 5.1.0) using number of reads per cell and percentage of mitochondrial reads. The inferCNV package (version 1.12.0) of the Trinity CTAT Project (https://github.com/broadinstitute/inferCNV) was then used to infer copy number variations. In brief, gene expression measurements of unedited cells were subtracted from those of edited cells using base R and dplyr (version 1.1.4). The edited cells were then clustered based on their residual gene expression levels up to the target site (chr12:6,538,000). Subsequently, these data were summarized in a heatmap focusing on chromosome 12 using the packages ggplot2 (version 3.5.1) and ComplexHeatmap (version 2.20.0). Additionally, the mean residual gene expression of genes spanning from the start of chromosome 12 to the target site was calculated and compared to the mean residual gene expression of the following 7 Mb (chr12:6,538,000–13,638,000).
ddPCR
ddPCR analysis was conducted using the QX200 ddPCR System and QuantaSoft software version 1.7.4.0917 (Bio-Rad) according to the manufacturer’s instructions.
For VCN quantification of the FIRE reporter in the K-562 cell line, ddPCR assays were designed to target the U5-Psi region of the integrated lentiviral sequence and RPP30 for normalization. Droplets were generated using the QX200 AutoDG Droplet Generator (Bio-Rad) from a reaction mixture containing 50 ng of gDNA, 1× ddPCR Supermix for Probes (No dUTP) (Bio-Rad, 186-3024), 1× ddPCR assays (900 nM of each forward and reverse primer, 250 nM probe; Bio-Rad) and 10 U µg−1 DNA of the HaeIII restriction enzyme (NEB, R0108S) cutting outside of the amplicons. Generated droplets were then subjected to thermal cycling (10 min at 95 °C, 40 cycles of 30 s at 94 °C and 1 min at 60 °C, 10 min at 98 °C).
For copy number quantification in edited K-562 cells, ddPCR assays were designed to target the eGFP cassette, KMT2C, and an intergenic region (chr3:46,270,956–46,271,086) for normalization. In brief, 400–1,700 ng of gDNA was digested by HindIII-HF (20 U per reaction) and 1× rCutSmart buffer (NEB, R3104S and B6004S), followed by a 3-h incubation at 37 °C. The digested DNA was five-fold diluted in a buffer containing 2 ng μl−1 sheared salmon sperm DNA (Invitrogen, AM9680) and 0.05% Pluronic F-68 non-ionic surfactant (Gibco). Droplets were generated as described above but using the QX200 Droplet Generator (Bio-Rad) and 20 μl of diluted solution of digested gDNA. Generated droplets were then subjected to thermal cycling (10 min at 95 °C, 40 cycles of 30 s at 94 °C and 1 min at 57 °C, 10 min at 98 °C). Measurement and quantification were conducted using a QX200 Droplet Reader and QuantaSoft software (Bio-Rad).
Sanger sequencing
Primer sequences used for Sanger sequencing are listed in Supplementary Table 5. In brief, a 599-bp region surrounding the target site of the FIRE reporter system from edited K-562 cells was amplified using NEBNext High-Fidelity 2× PCR Master Mix. The PCR products were purified using 1.8× SPRI beads. Subsequently, 1 µl of the purified PCR products underwent analysis using an Agilent 2200 TapeStation and TapeStation software version 5.1, along with D1000 ScreenTape and D1000 reagents, according to the manufacturer’s protocol. The purified samples were then subjected to Sanger sequencing (Microsynth AG), and the resulting traces were deconvoluted and analyzed using ICE40.
CAST-seq
Primer sequences used for CAST-seq are listed in Supplementary Table 5. CAST-seq analyses were performed as previously described, with a few modifications25. In total, 200–220 ng of gDNA was used as input material for each technical replicate. Libraries were prepared using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB, E7805L). Enzymatic fragmentation of the gDNA was aimed at an average length of 500–700 bp. CAST-seq libraries were sequenced on a NextSeq 2000 using 2 × 150-bp paired-end sequencing. For each sample, two technical replicates were run and analyzed, except for RPE-1 p53+/+ edited at CCR5 (n = 1). When two replicates were performed, only sites that were present in both technical replicates and significant in at least one replicate are shown in the circos plots and in Supplementary Table 2. For sites under investigation, the spacer sequence of the sgRNA was aligned in a window of ±400 bp around the most covered regions for each site. Sites were labeled as OMT if any of the two P values reached the cutoff of 0.005 (ref. 26).
Statistical analysis
GraphPad Prism 10 software was used for statistical analysis. Results are presented as mean ± s.d. or as the mean only when there were fewer than three replicates.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
